Sequence Alignments (skbio.alignment
)#
This module provides functionality for computing and manipulating sequence alignments. DNA, RNA, and protein sequences can be aligned, as well as sequences with or without custom alphabets.
See the Tutorial section for performing and working with sequence alignments using scikit-bio.
Alignment structures#
Tabular format of aligned sequences.
|
Store a multiple sequence alignment in tabular (row/column) form. |
Compact format of alignment paths.
|
Store an alignment path between sequences. |
|
Store a pairwise alignment path between two sequences. |
Pairwise alignment#
A versatile, efficient and generalizable pairwise alignment algorithm.
|
Perform pairwise alignment of two sequences. |
Convenience wrappers with preset scoring schemes.
|
Align two nucleotide sequences. |
|
Align two protein sequences. |
Alignment statistics#
|
Calculate the alignment score of two or more aligned sequences. |
Deprecated functionality#
Pure Python algorithms (slow; educational-purposes only)
|
Globally align nucleotide seqs or alignments with Needleman-Wunsch. |
|
Globally align pair of protein seqs or alignments with Needleman-Wunsch. |
|
Globally align a pair of seqs or alignments with Needleman-Wunsch. |
|
Locally align exactly two nucleotide seqs with Smith-Waterman. |
|
Locally align exactly two protein seqs with Smith-Waterman. |
|
Locally align exactly two seqs with Smith-Waterman. |
Tutorial#
Sequence alignment is the process of arranging biological sequences such that they resemble each other when positioned together. The alignment reveals the degree of similarity between sequences, which may indicate evolutionary relationships (i.e., “homology”) and/or structural and functional relevance. The alignment process permits only one operation: shifting characters by inserting gaps (-) between them. Shuffling characters is not permitted.
Quick start#
To demonstrate this process, let’s create two DNA sequences.
>>> from skbio.sequence import DNA
>>> seq1 = DNA('ACTACCAGATTACTTACGGATCAGGTACTTGCCAACAA')
>>> seq2 = DNA('CGAAACTACTAGATTACGGATCTTACTTTCCAGCAAGG')
Just by eyeballing, we can observe some local similarities between the sequences, particularly in the middle sections. However, the beginning and ending portions aren’t so similar between the two.
Apply pair_align_nucl
to perform pairwise alignment of the two nucleotide
sequences.
>>> from skbio.alignment import pair_align_nucl
>>> aln = pair_align_nucl(seq1, seq2)
>>> aln
PairAlignResult(score=22.0, paths=[<PairAlignPath, positions: 44, segments: 7, ...
The result contains score
and paths
. The latter is a list of optimal alignment
paths calculated by the algorithm. By default, only one path will be returned, which is
all we need in most applications.
>>> aln.paths[0]
<PairAlignPath, positions: 44, segments: 7, CIGAR: '4I13M4D6M2D13M2I'>
To obtain aligned sequences, we can call the to_aligned
method of
the path.
>>> aln.paths[0].to_aligned((seq1, seq2))
['----ACTACCAGATTACTTACGGATCAGGTACTTGCCAACAA--',
'CGAAACTACTAGATTAC----GGATCT--TACTTTCCAGCAAGG']
As we can see, by inserting four consecutive gaps in the appropriate positions, the two sequences appear more similar, or “aligned”, with one another.
The score measures the goodness of the alignment. The value is dependent on the sequences and the alignment parameters (discussed below).
>>> aln.score
22.0
Likewise, we can align protein sequences with pair_align_prot
:
>>> from skbio import Protein
>>> from skbio.alignment import pair_align_prot
>>> pair_align_prot(Protein("HEAGAWGHEE"), Protein("PAWHEAE"))
PairAlignResult(score=15.0, paths=[<PairAlignPath, positions: 13, segments: 3, ...
Alignment algorithm#
The alignment algorithm aims to find the optimal alignment path(s) that yield the
highest possible alignment score for two sequences. For decades,
dynamic programming (DP) has been the gold standard for
pairwise sequence alignment, and is widely covered in many bioinformatics textbooks.
scikit-bio also implements this algorithm. pair_align_nucl
and pair_align_prot
are but convenience wrappers for the function pair_align
, which offers multiple
customizable parameters and comprehensive documentation explaining the algorithm and
everything you need to know for using it.
>>> from skbio.alignment import pair_align
By referring to the documentation of pair_align
, we can customize the algorithm’s
behavior to best suit our research objectives. The default mode is global alignment,
as in the Needleman-Wunsch algorithm (which you may recall from textbooks), with both
ends free of gap penalty (a.k.a., “semi-global alignment”, or “overlap alignment”, in
some literature).
Next, we will switch to local alignment, as in the Smith-Waterman algorithm.
>>> aln = pair_align(seq1, seq2, mode="local")
>>> aln
PairAlignResult(score=13.0, paths=[<PairAlignPath, positions: 25, segments: 3, ...
>>> aln.paths[0].to_aligned((seq1, seq2))
['TTACGGATCAGGTACTTGCCAACAA', 'TTACGGATCT--TACTTTCCAGCAA']
As shown, the alignment is shorter than that of the global alignment, and truncated: only the highly similar regions in the middle of the two sequences are preserved, while the less similar regions at both ends are discarded.
We can further tweak the alignment parameters. The wrapper function pair_align_nucl
uses parameters that are consistent with NCBI BLASTN’s defaults. To replicate this
behavior using pair_align
, we can proceed as follows:
>>> aln = pair_align(seq1, seq2, mode="global", sub_score=(2, -3), gap_cost=(5, 2))
>>> aln
PairAlignResult(score=22.0, paths=[<PairAlignPath, positions: 44, segments: 7, ...
Here, 2 and -3 in sub_score
represent match and mismatch scores (added to the
alignment score). 5 and 2 in gap_cost
represent gap opening and gap extension
penalties (subtracted from the alignment score). The use of two gap penalty values is
known to as affine gap penalty.
Let’s try an alternative setting. The follow parameters uses a nucleotide substitution matrix “NUC.4.4” to replace match/mismatch scores. This provides more flexibility in defining the score between pairs of characters. For example, when there are degenerate characters in the DNA sequences, such as “R” and “Y”, the substitution matrix usually models the substitution scores more realistically. In addition, this setting uses a simple linear gap penalty scheme to replace the more sophisticated affine gap penalty scheme.
>>> aln = pair_align(seq1, seq2, mode="global", sub_score="NUC.4.4", gap_cost=3)
>>> aln
PairAlignResult(score=106.0, paths=[<PairAlignPath, positions: 44, segments: 7, ...
Scikit-bio also provides an align_score
function to calculate the alignment
score of an existing alignment. You will need to supply the same parameters to get the
same outcome.
>>> from skbio.alignment import align_score
>>> align_score((aln.paths[0], (seq1, seq2)), sub_score="NUC.4.4", gap_cost=3)
106.0
Pairwise alignment is often taught in bioinformatics courses. By adding
keep_matrices=True
to the function, the alignment matrix calculated during the DP
process will be retained. This can be particularly useful for educational purposes.
>>> score, (path,), (matrix,) = pair_align(
... "GATCT", "GTAC", mode="global", free_ends=False, keep_matrices=True)
>>> matrix
array([[ 0., -2., -4., -6., -8.],
[ -2., 1., -1., -3., -5.],
[ -4., -1., 0., 0., -2.],
[ -6., -3., 0., -1., -1.],
[ -8., -5., -2., -1., 0.],
[-10., -7., -4., -3., -2.]]...
Alignment path#
A pairwise alignment path is an instance of the PairAlignPath
class, which in
turn is a subclass of the AlignPath
class. This class implements an efficient
data structure to store the “path”, i.e., the events of placing gaps inside sequences.
It uses run-length encoding (RLE) under the hood, and does not store the sequence data,
such that its memory cost is minimum. Refer to the class documentation for details of
this data structure.
>>> path = aln.paths[0]
>>> path.lengths
array([ 4, 13, 4, 6, 2, 13, 2])
>>> path.states
array([[1, 0, 2, 0, 2, 0, 1]], dtype=uint8)
The path can be represented by a CIGAR string, which is a common format used by many high-throughput pairwise alignment tools.
>>> path.to_cigar()
'4I13M4D6M2D13M2I'
The letters in the CIGAR string represent the gap-placing events: I
(insertion):
gap in sequence 1, D
(deletion): gap in sequence 2, M
(mis/match): gap in
neither sequence. The numbers represent the length of each segment. As you may have
noticed, the PairAlignPath
data structure resembles the CIGAR encoding. In this
example, the alignment path contains four consecutive gaps flanking four chunks of
(mis)matched characters.
If we pass the sequences to the to_cigar
method, we will get
=
(match, i.e., same character) and X
(mismatch, i.e., different characters)
instead of M
.
>>> path.to_cigar((seq1, seq2))
'4I5=1X7=4D5=1X2D5=1X3=1X3=2I'
One can construct a PairAlignPath
from a CIGAR string using the
from_cigar
method. Likewise, this process doesn’t rely on the
sequence data. Therefore, it is suitable for handling many CIGAR strings from large
data files, such as those in SAM/BAM formatted files.
>>> from skbio.alignment import PairAlignPath
>>> path = PairAlignPath.from_cigar('1I8M2D5M2I')
>>> path
<PairAlignPath, positions: 18, segments: 5, CIGAR: '1I8M2D5M2I'>
This method can also be used to parse CIGAR-formatted alignment results of external sequence alignment tools, such as Parasail.
import parasail
res = parasail.nw_trace(...)
path = PairAlignPath.from_cigar(res.cigar.decode)
AlignPath
is a more generalized data structure that supports an arbitrary number
of sequences. For example, we can directly construct a path of three aligned sequences
using the from_aligned
method:
>>> from skbio.alignment import AlignPath
>>> path = AlignPath.from_aligned([
... 'CGTCGTGC',
... 'CA--GT-C',
... 'CGTCGT-T',
... ])
>>> path
<AlignPath, sequences: 3, positions: 8, segments: 5>
>>> path.lengths
array([2, 2, 2, 1, 1])
>>> path.states[0]
array([0, 2, 0, 6, 0], dtype=uint8)
The AlignPath
(as well as PairAlignPath
) class serves as a central hub for
interacting with different alignment formats and tools. For example, the
from_coordinates
method can parse BioPython’s alignment results
(and vice versa with to_coordinates
).
from Bio import Align
res = Align.PairwiseAligner().align(...)
path = AlignPath.from_coordinates(res[0].coordinates)
The from_indices
method can parse Biotite’s alignment results
(and vice versa with to_indices
).
from biotite.sequence.align import align_optimal
res = align_optimal(...)
path = AlignPath.from_indices(res[0].trace.T)
Tabular alignment#
In addition to alignment paths, scikit-bio provides TabularMSA
, a tabular data
structure that hosts aligned sequences (“MSA” stands for multiple sequence alignment).
One can convert an alignment path and the original (unaligned) sequences into a
TabularMSA
object using the from_path_seqs
method (and vice
versa with AlignPath.from_tabular
).
>>> from skbio.alignment import TabularMSA
>>> score, (path,), _ = pair_align_nucl(seq1, seq2)
>>> msa = TabularMSA.from_path_seqs(path, (seq1, seq2))
>>> msa
TabularMSA[DNA]
--------------------------------------------
Stats:
sequence count: 2
position count: 44
--------------------------------------------
----ACTACCAGATTACTTACGGATCAGGTACTTGCCAACAA--
CGAAACTACTAGATTAC----GGATCT--TACTTTCCAGCAAGG
Alternatively, one can read from a multi-FASTA file of aligned sequences:
msa = TabularMSA.read('input.fasta', constructor=DNA)
Or directly from aligned sequence objects:
>>> msa = TabularMSA([
... DNA('CGTCGTGC'),
... DNA('CA--GT-C'),
... DNA('CGTCGT-T'),
... ])
>>> msa
TabularMSA[DNA]
---------------------
Stats:
sequence count: 3
position count: 8
---------------------
CGTCGTGC
CA--GT-C
CGTCGT-T
A TabularMSA
object is iterally like a table. If you are also familiar with pandas
DataFrame, you can apply similar indexing methods to it.
>>> msa.index
RangeIndex(start=0, stop=3, step=1)
>>> msa.iloc[0]
DNA
--------------------------
Stats:
length: 8
has gaps: False
has degenerates: False
has definites: True
GC-content: 75.00%
--------------------------
0 CGTCGTGC
>>> msa.iloc[:, 1]
Sequence
-------------
Stats:
length: 3
-------------
0 GAG
Like Sequence
, TabularMSA
can be annotated with metadata.
>>> msa.metadata = {'name': 'test alignment'}
>>> msa.positional_metadata = {
... 'identity': [80, 85, 88, 90, 90, 95, 92, 86]}
The class provides some utilities for downstream analysis. For example, to obtain a consensus sequence of the alignment:
>>> msa.consensus()
DNA
------------------------------
Positional metadata:
'identity': <dtype: int64>
Stats:
length: 8
has gaps: True
has degenerates: False
has definites: True
GC-content: 71.43%
------------------------------
0 CGTCGT-C